Le sildénafil présent dans Kamagra exerce une inhibition réversible de la PDE5, modulant la cascade GMPc et favorisant une vasodilatation localisée. L’absorption digestive varie selon la forme utilisée, comprimés classiques ou gels oraux. La distribution tissulaire est large et la liaison protéique élevée, avoisinant 96 %. La métabolisation hépatique génère un métabolite actif contribuant à l’effet pharmacologique global. La demi-vie reste courte, avec disparition plasmatique en quelques heures. Les interactions significatives concernent surtout les nitrés organiques et inhibiteurs puissants du CYP3A4. Dans les publications techniques, kamagra en ligne est souvent cité dans le cadre d’analyses comparatives portant sur les différences de formulations et de cinétique d’absorption.

Tavernarakislab.gr


Insect Molecular Biology (2006) 15(1), 95–103
Germ line transformation of the olive fly Bactrocera oleae
using a versatile transgenesis marker

M. Koukidou1*†, A. Klinakis1*†‡, C. Reboulakis§,
presents an increasing challenge to pest control. Progress L. Zagoraiou*†¶, N. Tavernarakis*, I. Livadaras*,
in molecular manipulation of insect species is an important A. Economopoulos§ and C. Savakis*†
way to further comprehension of the genetic and biochemical *Institute of Molecular Biology and Biotechnology, basis of insect biology. In addition, it will open the way for Foundation for Research and Technology, Heraklion, novel strategies to control insect pest populations, as, for Crete, Greece; †Medical School and §Department of example, through production of insects for sterile insect Biology, University of Crete, Heraklion, Greece The technologies for insect transgenesis developed so far rely on transposable elements. Manipulation of an insect Abstract
genome with a transposable element was first achieved in The olive fruit fly (olive fly) Bactrocera oleae (Dacus),
Drosophila with the P element (Rubin & Spradling, 1982).
recently introduced in North America, is the most
However, the host range of P seems to be restricted to the destructive pest of olives worldwide. The lack of an
drosophilids (Handler et al., 1993). The discovery of new efficient gene transfer technology for olive fly has
elements with a broader host range has led to the develop- hampered molecular analysis, as well as development
ment of vector systems for transformation of several non- of genetic techniques for its control. We have developed
drosophilid insect species, including the Mediterranean fruit a Minos-based transposon vector carrying a self-
fly Ceratitis capitata (Loukeris et al., 1995b; Handler et al., activating cassette which overexpresses the enhanced
1998; Michel et al., 2001), the mosquitoes Aedes aegypti green fluorescent protein (EGFP). Efficient transposase-
(Jasinskiene et al., 1998; Coates et al., 1998), Anopheles mediated integration of one to multiple copies of this
albimanus (Perera et al., 2002), Anopheles stephensi vector was achieved in the germ line of B. oleae by
(Catteruccia et al., 2000) and Anopheles gambiae (Grossman coinjecting the vector along with in vitro synthesized
et al., 2001), the housefly Musca domestica (Hediger et al., Minos transposase mRNA into preblastoderm embryos.
2001), the Australian sheep blowfly Lucilia cuprina (Heinrich The self-activating gene construct combined with trans-
et al., 2002), the silkmoth Bombyx mori (Tamura et al., posase mRNA present a system with potential for
2000), the beetle Tribolium castaneum (Lorenzen et al., transgenesis of very diverse species.
2003; Pavlopoulos et al., 2004) and the New World screw-worm Cochliomyia hominivorax (Allen et al., 2004).
Keywords: Olive fruit fly; Bactrocera oleae; germ line
Bactrocera oleae is the main pest of olives in the transformation; transgenesis marker.
Mediterranean region and in California, where it has beenintroduced recently. Currently, control of B. oleae is based Introduction
on the use of insecticides either in bait or in cover sprays,resulting in adverse effects on the environment and some- Arthropods are key pests of food and fibre crops as well times presence of unacceptably high levels of insecticides as major disease vectors. Field resistance to pesticides in olives and olive oil (Ferreira & Tainha, 1983). Develop-ment of olive fly control strategies leading to reduced or no use of insecticides has been attempted with mixed results, Received 18 April 2005; accepted after revision 29 August 2005. Corre-spondence: Charalambos Savakis, Medical School, University of Crete for example, ‘lure and kill’ (Haniotakis et al., 1991), localized and IMBB-FoRTH, PO Box 1527, Heraklion 71110, Crete, Greece.
bait spray (Pucci, 1990) and inundative or inoculative Tel.: +30 2810391114, fax: +30 2810391950, E-mail: savakis@imbb.forth.gr release of parasitoids (Tzanakakis, 1995). SIT has been Current addresses: ‡Department of Genetics and Development, Columbia used with limited success (Economopoulos et al., 1977), University, NY, USA, ¶Center for Neurobiology and Behaviour, ColumbiaUniversity, NY, USA apparently because of low competitiveness of the mass- 1These authors contributed equally to this work.
reared males compared to the wild males (Economopoulos & Zervas, 1982). Availability of a method for olive flytransgenesis is a prerequisite for genetic manipulation ofthis species for development of more effective controlmethods, such as release of insects carrying a dominantlethal allele (RIDL) strategies (Heinrich & Scott, 2000;Thomas et al., 2000) and sensitization of insect populationsto pro-insecticides (SIPP) (Markaki et al., 2004).
The transposon Minos from Drosophila hydei belongs to the Tc1/Mariner family of transposable elements (Franz& Savakis, 1991) which, in addition to insects, has beenshown to mediate transgenesis in human cells (Klinakiset al., 2000a), in mouse somatic and germ cells (Zagoraiouet al., 2001; Drabek et al., 2003) and in the ascidian Cionaintestinalis (Sasakura et al., 2003). Encouraged by thisbroad host range, we attempted germ-line transformationof B. oleae with a Minos vector carrying an enhanced greenfluorescent protein (EGFP) gene. EGFP is a universalmarker for insect transgenesis (Berghammer et al., 1999).
In this report, we describe a self-stimulating transcription system for high levels of regulatable expression of markergenes in diverse species. Using this system in combinationwith a Minos transposon, we demonstrate stable and efficienttransgenesis of B. oleae.
A potentially universal EGFP-based genetic marker To achieve high levels of EGFP expression, we used aself-activating and self-sustained positive feedback loopbased on the tetracycline-sensitive transcriptional activatortTA (Gossen & Bujard, 1992), which is based on con-comitant expression of EGFP and tTA from a bi-directionalpromoter driven by tTA. Two versions of the expressioncassette were generated. The first version was derivedfrom a commercially available cassette consisting of a 7-merof the tetracycline operator (tetO) (Gossen & Bujard, 1992)flanked by two divergent copies of a cytomegalovirus(CMV) minimal promoter (the ‘mammalian version’). Thesecond was constructed for use in insects and consistedof a 14-mer of the tetO element flanked by two divergentcopies of the minimal promoter of the Drosophila mela-nogaster hsp70 gene (the ‘insect version’). A 14-mer wasused in the insect version in order to maximize expressionlevels (Fig. 1, top).
The insect cassette was tested in D. melanogaster and in the medfly Ceratitis capitata by P- and Minos-based germline transformation, respectively. In D. melanogaster, most Figure 1. Top: the tTA/enhanced green fluorescent protein (EGFP)
self-stimulating expression cassette. Bottom: EGFP expression.
of the transgenic lines exhibited strong, ubiquitous and (a–d) transformed Drosophila melanogaster adults, embryos, third instar constitutive expression of EGFP throughout development larva and pupae; red arrowheads point to non-transformed individuals. (Fig. 1a – d), while only some lines showed tissue-specific (e–f) Transformed medfly pupa and adult. (g–h) Human HeLa cells stably transfected with insect and mammalian cassette, respectively. (i–j) Nicotiana expression patterns (not shown). Fluorescence was less tabacum leaf transiently transfected with insect and mammalian cassette, intense in medfly transformants, which were characterized respectively. (k) Transgenic Caenorhabditis elegans animal harbouring a by specific patterns of expression during development plasmid vector carrying the insect cassette.
2006 The Royal Entomological Society, Insect Molecular Biology, 15, 95–103
Germ line transformation of the olive fruit fly The versatility of the bidirectional loop was further explored in somatic cells of animals and plants. HeLa cells Olive fly transformation with a Minos element were transiently and stably transfected with both the Preblastoderm embryos of the B. oleae Demokritos strain ‘mammalian’ and the ‘insect’ construct; fluorescence was were coinjected with the Minos-based ‘insect’ construct and detectable 24 h post transfection (Fig. 1g–h) and peaked Minos transposase mRNA, a method that has been previ- 48 h post-transfection. The same constructs were also ously shown to result in high transformation frequencies introduced into tobacco leaves (Nicotiana tabacum and (Kapetanaki et al., 2002). Transient EGFP expression was N. bentamiana) via gold particle ‘bombardment’; examination observed in about 60% of the injected embryos examined 48 h post transfection showed strong EGFP expression in (Fig. 2, panels A to C), indicating that the genetic marker is certain cells (Fig. 1i – j). The ‘insect’ vector was also intro- duced into the nematode Caenorhabditis elegans, leading From the 3833 injected G0 embryos, 641 larvae hatched, to strong and uniform EGFP expression (Fig. 1k).
from which 151 male and 174 female flies developed. The Experiments performed in Drosophila and in HeLa cells male G0 flies were mated in a single cage to 506 non- carrying stable, active integrations of the tTA-containing injected female flies, and the female G0 flies were mated in cassette showed that EGFP expression is reversibly sup- another cage to 250 wild-type male flies. The G1 progeny pressed by the teracycline analogue doxycycline at con- from the two crosses was screened for EGFP fluorescence centrations known to inhibit tTA binding to the promoter at the third instar larval stage. A total of 8824 third instar (data not shown). Furthermore, high levels of EGFP expres- larvae was screened; 67 of them exhibited green fluores- sion were dependent on the presence of the bidirectional cence in various tissues and were therefore considered loop because no fluorescence was obtained from control constructs containing the bidirectional promoter without the To establish transformed lines, 13 individual G1 flies were back-crossed to wild-type flies and the resulting G2 Figure 2. Patterns of enhanced green fluorescent
protein (EGFP) expression in injected embryos and
in transformed Bactrocera oleae individuals.
(a–c) Injected eggs showing various patterns of
transient EGFP expression. (d–f) EGFP expression
in larva, pupa and adult G2 progeny from line 12.
(g–i) EGFP expression in larva, pupa and adult G2
progeny from line 10. ( j–l) EGFP expression in larva,
pupa and adult G2 progeny from line 9.
(m–o) Nontransformed larva, pupa and adult.
2006 The Royal Entomological Society, Insect Molecular Biology, 15, 95–103
Figure 3. Frequencies of transformants among the olive fly G2 progeny.
enhanced green fluorescent protein (EGFP)-expressing G1 progeny
was individually backcrossed to wild-type flies. The G2 progeny was
screened for EGFP expression. Bars indicate the total number of G2 flies
Figure 4. Southern blot analysis of transformed olive fly lines. Top:
from each G1 parent. The proportion of G2 progeny expressing the EGFP schematic of the ‘insect version’ transposon. The bar indicates the fragment marker is also indicated. No G2 progeny were obtained from cage numbers used as probe for Southern blot analysis. Bottom: Southern blots of the EcoRI digested genomic DNA from individual enhanced green fluorescent protein (EGFP)-expressing G2 progeny. Line numbers are indicated at the top of the panel. Marker values are in kilobases.
third instar larvae were again screened for EGFP expression.
Four of the crosses did not give any progeny. Where numbers Molecular analysis of the transformed lines allowed assessment, the proportion of progeny expressing Insertion of the Minos element into the B. oleae genome the EGFP marker was consistent with segregation of a was verified by Southern blot analysis on EcoRI-digested genomic DNA with an EGFP probe. Any single, transposase- Clearly detectable EGFP fluorescence was observed in dependent insertion of the transposon into genomic DNA is second and third instar larvae, pupae and adult flies in all expected to give a band of at least 1300 bp in size. Based transformed lines examined. Nine independent transformed on this criterion, the presence of a single insertion was lines were established (lines 2, 5, 6, 8, 9, 10, 11, 12 and 13).
detected in progeny of transgenic flies 2, 5 and 6, while The pattern of EGFP expression differed considerably from progeny of transgenics 8, 9, 10, 11, 12 and 13 contained line to line (Fig. 2). Furthermore, some lines showed vari- multiple insertions (Fig. 4). Of the nine cases analysed, ability of EGFP expression (variegation) between siblings, only two, 5 and 6, were found to yield a band of the same although the overall pattern was characteristic (lines 9, 11 size (Fig. 4). Additionally, these two showed the same pat- and 13; data not shown). With one exception (line 9), tern of EGFP expression, suggesting that they represent patterns of expression did not change through the genera- the same transformation event. The others were regarded tions. At least two different expression patterns were as independent transformation events. Southern blot ana- detected and were segregating in line 9, one of which, lysis performed in individual flies from lines 13 and 11 at highly localized, is shown in Fig. 2(j – l). Because line 9 subsequent generations showed that some of the bands contained multiple insertions, it is likely that two active were lost, clearly suggesting that individual bands repre- insertions (i.e. insertions expressing EGFP) existed in this sent independent, unlinked integrations of the element line, each with a distinct pattern of expression. Transmis- sion of the EGFP marker has been maintained in all lines To verify that the insertions are indeed transposase- for at least eight generations, demonstrating that the mediated, integration sites were amplified by inverse PCR marker is stably inherited, as expected in the absence of (Triglia et al., 1988) from four of the lines. The PCR prod- ucts were cloned and sequenced. As shown in Fig. 5, each Binding of the transcriptional activator tTA to its target is of the four integration sites contains the Minos inverted ter- inhibited by tetracycline (Gossen & Bujard, 1992). Tetracycline- minal repeat followed by a TA dinucleotide and a sequence dependence of EGFP expression was tested in one of the not present in the original plasmid. We therefore conclude lines (line 12), which is characterized by high levels of that the Minos construct inserts through transposition and fluorescence in all stages. Fluorescence is not detectable in larvae of line 12 grown on medium containing 10 mg / l The sequences adjacent to the insertion sites were subjected to BLAST analysis against GENBANK. In two of the 2006 The Royal Entomological Society, Insect Molecular Biology, 15, 95–103
Germ line transformation of the olive fruit fly Figure 5. Sequences flanking Minos insertions. The
end of the transposon sequence is in bold face. The
MboI restriction site used in inverse PCR is underlined.
The TA target dinucleotide is indicated.
sites analysed, the retrieved flanking sequences were too for transformants, which was performed in the absence of short to allow a meaningful BLAST analysis (Fig. 5). One of tetracycline and was based on EGFP expression. We the two other sequences (line 10) showed a 91% identity observed, nevertheless, tetracycline-repressible lethality (E-value: 2e-11) to a region within the large intron of the in a number of Drosophila transformants, only in the corkscrew gene of Drosophila (see Supplementary Material).
homozygous form. As we did not perform a systematicscreen for dominant tet-repressible lethals, we cannot estim-ate the frequency of tTA-induced lethal transgenes carrying Discussion
our bidirectional tTA/EGFP construct. It is also possible that We have constructed a versatile marker cassette, in which the strong lethality observed by Gong et al. (2005) may be the EGFP gene is expressed from a bidirectional promoter caused by higher levels of tTA, as a tTA variant was used controlled by the synthetic transcriptional activator tTA which is optimized for expression in D. melanogaster. (Gossen & Bujard, 1992); the promoter also drives the Using the tTA/EGFP self-sustaining cassette, we have expression of tTA. This results in self-sustaining expression shown that the transposable element Minos from D hydei of the tTA activator. This positive-feedback system should can mediate stable germ-line transformation of B. oleae, be constitutively active once transcription is initiated, for thus extending the number of species that have been example from an enhancer near the site of insertion.
transformed with this element. Transformation frequency, The marker cassette presents several interesting fea- expressed as the fraction of G0 individuals producing trans- tures. Firstly, strong EGFP expression in most stages of formed progeny, could not be estimated from these experi- development, allowing easy selection of transformants.
ments due to the fact that G0 flies were bred in groups.
Secondly, the marker is active in diverse organisms, However, the overall number of phenotypically detectable because it depends on the versatile tTA/tetO system rather transformation events (67 EGFP expressing G1 progeny than a host-derived promoter. Thirdly, transient expression from 325 G0 adults) is sufficient to produce several of the marker in embryos injected with DNA, allowing early independent transformants from a single experiment, as assessment of injection efficiency and functionality of the thousands of embryos can be injected and hundreds of G0 marker. This can be a highly desirable property, especially adults can be obtained within the productive 10-day period for transformation of species that have a long generation time or are difficult to breed. Fourthly, the EGFP expression Of the nine transformed lines analysed, three lines had a patterns differ widely between different insertions in some single copy of the transgene, line 11 carried two copies, species such as in medfly and in olive fly, a feature that can lines 10 and 12 three and lines 8, 9 and 13 contained more be used to distinguish easily between different transgenic than three copies, contrary to other Minos-based trans- lines. Additionally, the system can be used as a base for formation experiments (Loukeris et al., 1995a,b) where most conditional expression of exogenous genes in various spe- of the individuals analysed contained a single copy of the cies. The results presented here suggest that the system transgene. This difference may be a function of the species may also be useful as a sensitive enhancer-trap (Bellen transformed. Alternatively, it may be the result of high levels et al., 1989; Wilson et al., 1989) for identification of tissue- of transposase in embryos injected with mRNA, rather than or stage-specific genes in diverse species.
with a transposase-expressing plasmid (Kapetanaki et al., It has been shown recently that a construct expressing 2002). The presence of multiple Minos insertions in lines tTA from a tetO promoter causes tetracycline-repressible such as line 13, which show Mendelian inheritance of lethality in transgenic medfly (Gong et al., 2005); toxicity of EGFP expression, suggests that all insertions except one overexpressed tTA was presumably the cause of lethality.
are silent, that is, they do not express EGFP. This is sup- Such lethals would not have been recovered in our screen ported by the observation that in subsequent generations 2006 The Royal Entomological Society, Insect Molecular Biology, 15, 95–103
some of the insertions are lost without apparent changes in EGFP expression patterns. A possible explanation for the Donor plasmid pMiBO14/GtTA2, containing the ‘insect’ self- existence of silent insertions is discussed below.
sustaining marker expression cassette was constructed as follows: Multiple integrations, although useful for enhanced trans- The EGFP cassette along with the hsp70 minimal promoter and gene expression, may increase the potential for lethal or the SV40 polyadenylation sequence was isolated from p3XP3-EGFP (Horn & Wimmer, 2000) as a Bst BI (filled-in)/ClaI fragment semilethal mutations, decreasing the viability of transgenic and was cloned into the EcoRV and ClaI sites of pBluescript II SK lines and furthermore, may complicate applied use of trans- (+) (Stratagene, La Jolla, CA, USA) to generate pBS / hsTATA- genic strains. This, however, could be avoided by using EGFP. The tetracycline operator (tetO) sequence was obtained as transposase-expressing helper plasmids or lower concen- an AluI fragment from PBI-L (Clontech, Mountain View, CA, USA).
trations of transposase mRNA in embryo injections.
Two copies of this fragment were cloned into the SmaI site of Patterns of EGFP fluorescence varied dramatically pBluescript II SK (+) to give a tetO-14mer (pBS/14tetO). The among different transgenic lines of olive fly (Fig. 2) and hsp70 minimal promoter, the tTA gene, the hsp70 polyadenylationsequence and the tetO 14mer (tetO-14) were then cloned into an medfly (Fig. 1); in these species EGFP expression was EcoRI/NotI-digested pBS/hsTATA-EGFP in a five-fragment ligation characteristically tissue-specific and variegated. In con- giving pBO14/GtTA. The hsp70 minimal promoter was on a trast, the majority of Drosophila transformants carrying BamHI/KpnI fragment from plasmid p3XP3-EGFP (Horn & Wim- single insertions of the self-stimulating cassette exhibited mer, 2000), hsp70pA was on a XbaI/NotI fragment from plasmid strong and ubiquitous expression of EGFP (Fig. 1). Expres- pHSS6hs/LMi2 (Loukeris et al., 1995b) and tetO-14 was on a sion of the EGFP gene from the self-activating construct BamHI/NotI fragment from pBS / 14tetO. The tTA gene was a KpnI/ used in these experiments depends on initial activation NheI fragment from plasmid pBI / GtT. Plasmid pBI / GtT was con-structed as follows: the EGFP gene was cloned on a Pst I/XbaI (triggering) of the minimal Hsp70 promoter. It is known that fragment from plasmid pEGFP-N1 pBI/GtT (Clontech) into plasmid the complete Drosophila Hsp70 promoter exhibits low pPBI-l (Clontech), replacing the luciferase gene, resulting in plasmid activity in transgenic non-Drosophila species (Berger et al., pPB1-g. The tTA gene derived from pUHD15-1 plasmid (Gossen 1985; our own unpublished results from medfly). It is pos- & Bujard, 1992) on a EcoRI/BamHI fragment was then cloned sible that the minimal Drosophila Hsp70 promoter is also blunt into the PvuII site of pPB1-g, resulting in plasmid pBI / GtT.
less active in medfly and olive fly, failing to ‘trigger’ the self- The XhoI site of pBO14/GtTA was destroyed by fill in to give sustaining loop in these species, unless the transposon has pBO14/GtTA2. An XhoI/XbaI fragment of this vector containing thewhole cassette except for the tTA gene and the hsp70pA was inserted near an active enhancer. This could explain both cloned into pMiLRtetR (Klinakis et al., 2000b) to give pMiBO14-G.
tissue-specific, variegated expression from some inser- The rest of the cassette from pBO14/GtTA2 was subsequently tions and lack of expression from others.
moved as an XbaI/NotI fragment into pMiBO14-G to reconstitute This report describes what appears to be a universal the tTA gene, resulting in pMiBO14/GtTA2. The donor plasmid genetic marker for detection of transgenic organisms and pMiBO7/GtTA was constructed in an analogous manner as its use for transgenesis of the major olive pest B. oleae by pMiBO14/GtTA2. Minos transposase mRNA was synthesized means of Minos-mediated germline transformation. With using the linearized plasmid pBlue(SK)MimRNA as a template(Pavlopoulos et al., 2004), according to the manufacturer’s instruc- this system, the olive fly is now amenable to transgenesis.
tions (Ambion mMessage mMachine T7 kit Austin, TX, USA).
Availability of a transformation system for B. oleae shouldnow make it possible to use genetic engineering for develop-ment of genetic strategies for control of this important Expression from the tTA/EGFP cassette in animal and plant cells Germ line transformation of D. melanogaster and Ceratitis capitatawas performed as described previously (Loukeris et al., 1995a,b).
HeLa cells were cultured and transfected with super-coiled plas- Experimental procedures
mid DNA by Ca++ coprecipitation as described previously (Klinakiset al., 2000b) and examined for EGFP fluorescence 12 h post- transfection. Transfection of Nicotiana tabacum leaf cells was The olive fruit flies used in this work originated from the Democri- carried out with a PDS-1000/Helios Bio-Rad gene-gun (Bio-Rad, tos Laboratories (Athens, Greece) B. oleae stock. Flies were bred Hercules, CA, USA). DNA was loaded on 1 µm gold particles.
locally at 25 °C, 45–50% relative humidity, under a 13 h light/11 h Bombardment was performed under vacuum using 1100 psi rup- dark cycle and were fed on a diet consisting of 100 g yeast hydro- ture discs and the leaf-disc-containing Petri dish was placed on the lysate, 400 g sugar, 30 g egg yolk and 250 mg streptomycin.
top shelf of the apparatus. Leaves were cultivated for two days in Newly hatched larvae were transferred on to the surface of larval Murashige and Skoog (SM) medium (Murashige & Skoog, 1962) medium consisting of 550 ml distilled water, 30 g soy hydrolysate, and were subsequently examined for EGFP fluorescence. Stand- 0.5 g potassium sorbate, 2 g Nipagin, 20 g sugar, 75 g brewer’s ard procedures were followed for Caenorhabditis elegans strain yeast, 30 ml concentrated HCl, 275 g cellulose powder, 20 ml olive maintenance, crosses and other genetic manipulations (Brenner, oil and 7.5 ml Tween-80 (Tzanakakis, 1989). Larvae burrowed into 1974). The nematode rearing temperature was kept at 20 °C.
the food and emerged again when ready to pupate. At this stage Supercoiled plasmid DNA was injected into the gonads of they were transferred into small plastic boxes for pupation. Pupae Caenorhabditis elegans N2 animals, together with plasmid pRF4 were kept at 25 °C until adult emergence.
carrying the dominant transformation marker rol-6(su1006) as 2006 The Royal Entomological Society, Insect Molecular Biology, 15, 95–103
Germ line transformation of the olive fruit fly described (Mello et al., 1992). Transgenic lines were obtained by a 32P-labelled GFP probe. The probe was a 720 bp BamHI/XbaI screening the F generation progeny of injected hermaphrodites fragment containing most of the GFP gene.
for roller animals. Individual transgenic rollers were examined forEGFP fluorescence.
Genomic DNA (5 µg) of transformants was digested with isoMboI Olive fly embryo collection and microinjection (Minotech Heraklion, Greece) and restriction fragments were cir- Adult females were allowed to oviposit on to ceresin wax cones for cularized by overnight ligation at 16 °C at a final concentration of 30 min. Deposited eggs were collected by rinsing with deionized 200 ng / ml. PCR was performed on the circularized fragments water and dechorionated for 1 min in 2.5% sodium hypochlorite, using primers Imio1 (5′-AAGAGAATAAAATTCTCTTTGAGACG- followed by extensive washes with deionized water. Eggs were 3′) and Imii1 (5′-CAAAAATATGAGTAATTTATTCAAACGG-3′), aligned on 24 × 50 mm cover slips using double-sided tape, the followed by a second round of nested PCR with primers Imio2 posterior pole of each egg facing the outer edge of the tape, and (5′-GATAATATAGTGTGTTAAACATTGCGC3′) and Imii2 (5′- covered with halocarbon oil (Sigma, St Louis, MO, USA). Transpo- GCTTAAGAGATAAGAAAAAAGTGACC3′) (Klinakis et al., 2000a).
son plasmid pMiBO14/GtTA2 (400 ng/µl) and helper RNA (100 ng/ PCR conditions were in both cases: 94 °C for 30 s; 58 °C for 30 s; µl) (Kapetanaki et al., 2002) in injection buffer (1) were coinjected 72 °C for 2 min; 30 cycles. PCR fragments were separated on a into the posterior pole of eggs, 45 –120 min after oviposition. Fol- 2% agarose gel. Purified fragments were cloned into vector lowing injection, G0 embryos were kept for 2–3 days in a humidi- pGEM-T easy (Promega, Madison, WI, USA) and sequenced fied Petri dish at 25 °C. Hatchlings were placed on larval food and grown as described above. G0 individuals were back-crossed tothe parental strain. G0 males were group-mated to virgin femaleflies in a standard Bactrocera oleae 30 × 30 × 30 cm cage at a Acknowledgements
1 : 4 (male : female) ratio; G0 females were group-mated to males We thank Dr Kriton Kalandidis for his help with plant cell at a 1 : 1 ratio. G1 eggs were collected daily until no more viable transformation and Drs Alexandros Kiupakis and Stefan eggs were produced. Eggs were washed with dH O and incubated at 25 °C for 48 h in 0.3% propionic acid for hatching. First instar lar- Oehler for critically reading the manuscript. This work was vae were transferred to 90 cm Petri dishes containing larval food.
supported by a Greek Secretariat for Research and G1 individuals were allowed to develop to third larval instar and Technology PENED grant to M.K., C.R., A.E., and C.S.
References
EGFP positive G1 individuals were transferred into small plastic Allen, M.L., Handler, A.M., Berkebile, D.R. and Skoda, S.R. (2004) boxes and left to pupate as described above. Single G1s were PiggyBac transformation of the New World screwworm, Coch- backcrossed to wild-type flies in small cages (5 × 5 × 10 cm). G1 liomyia hominivorax, produces multiple distinct mutant strains.
males were kept at a ratio of 1 : 6 with females, G1 females at a Med Vet Entomol 18: 1– 9.
ratio 1 : 1 with males. Thin domes of ceresin wax were introduced Bellen, H.J., O’Kane, C.J., Wilson, C., Grossniklaus, U., Pearson, into each cage as oviposition surfaces on the third day of adult life.
R.K. and Gehring, W.J. (1989) P-element-mediated enhancer Eggs were collected from the fifth day of adult life and subsequent detection: a versatile method to study development in Dro- collections occurred every other day until the 10th collection. Third sophila. Genes Dev 3: 1288 – 1300.
instar G2 larvae were screened for EGFP expression and the Berger, E.M., Marino, G. and Torrey, D. (1985) Expression of Dro- EGFP-positive larvae selected and backcrossed to the parental sophila hsp70-CAT hybrid gene in Aedes cells induced by heat strain as above. Three generations of backcrosses of EGFP- shock. Som Cell Molec Gen 11: 371– 377.
positive adults to the parental strain were performed. Subsequently, Berghammer, A.J., Klingler, M. and Wimmer, E.A. (1999) A univer- transformed lines were maintained by selection for EGFP positive sal marker for transgenic insects. Nature 402: 370 – 371.
Brenner, S. (1974) The genetics of Caenorhabditis elegans.
Genetics 77: 71– 94.
Catteruccia, F., Nolan, T., Loukeris, T.G., Blass, C., Savakis, C., Kafatos, F.C. and Crisanti, A. (2000) Stable germline trans- DNA from single adult flies was purified essentially as described formation of the malaria mosquito Anopheles stephensi. Nature previously (Laird et al., 1991). Flies were homogenized in 0.25 ml 405: 959 – 962.
50 mM Tris-HCl pH 8.0, 100 mM EDTA, 1% SDS, 100 mM NaCl, Coates, C.J., Jasinskiene, N., Miyashiro, L. and James, A.A. (1998) 330 µg/ml proteinase K and incubated at 55 °C overnight. Sam- Mariner transposition and transformation of the yellow fever mos- ples were treated with a DNAse-free RNAse solution (200 µg/ml) quito, Aedes aegypti. Proc Natl Acad Sci USA 95: 3748 – 3751.
at 37 °C for 1 h. This incubation was followed by two phenol/chlo- Drabek, D., Zagoraiou, L., deWit, T., Langeveld, A., Roumbaki, C., roform extractions and one chloroform extraction. The supernatant Mamalaki, C., Savakis, C. and Grosveld, F. (2003) Transposi- was transferred to a fresh tube, DNA was isopropanol precipitated, tion of the Drosophila hydei Minos transposon in the mouse washed with 70% ethanol and resuspended in 20 µl sterile ddH O.
germ line. Genomics 81: 108 – 111.
DNA concentrations were determined by spectrophotometry at Economopoulos, A.P. and Zervas, G.A. (1982) The quality prob- 260 nm. Five micrograms of genomic DNA were digested with lem in olive flies produced for SIT experiments. Invited inter- EcoRI, and the resulting fragments separated on a 0.8% agarose national symposium on the SIT and the use of radiation in gel. After transfer to nylon membranes, blots were hybridized with genetic insect control. IAEA SIT/PUB 592: 357– 368.
2006 The Royal Entomological Society, Insect Molecular Biology, 15, 95–103
Economopoulos, A.P., Artis, N., Zervas, G., Tsitsipis, G., Hanio- Klinakis, A.G., Zagoraiou, L., Vassilatis, D.K. and Savakis, C.
takis, G., Tsiropoulos, G. and Mamoukas, A. (1977) Control of (2000b) Genome-wide insertional mutagenesis in human cells the olive fly, Dacus oleae (Gmelin), by the combined effect of by the Drosophila moile element Minos. EMBO Reports 1:
insecticides and release of gamma sterilized insects. Z Angew Ent 83: 201– 215.
Laird, P.W., Zijderveld, A., Linders, K., Rudnicki, M.A., Jaenisch, R.
Ferreira, J.R. and Tainha, A.M. (1983) Organophosphorus insecti- and Berns, A. (1991) Simplified mammalian DNA isolation pro- cide residues in olives and olive oil. Pestic Sci 14: 167– 172.
cedure. Nucleic Acids Res 19: 4293.
Franz, G. and Savakis, C. (1991) Minos, a new transposable ele- Lorenzen, M.D., Berghammer, A.J., Brown, S.J., Denell, R.E., Klin- ment from Drosophila hydei, is a member of the Tc-1 like family ger, M. and Beeman, R.W. (2003) piggyBac-mediated germ- of transposons. Nucleic Acids Res 19: 6646.
line transformation in the beetle Tribolium castaneum. Insect Gong, P., Epton, M.J., Fu, G., Scaife, S., Hiscox, A., Condon, K.C., Mol Biol 12: 433 – 440.
Condon, G.C., Morrison, N.I., Kelly, D.W., Dafa’alla, T., Cole- Loukeris, T.G., Arca, B., Livadaras, I., Dialedtaki, G. and Savakis, man, P.G. and Alphey, L. (2005) A dominant lethal genetic sys- C. (1995a) Introduction of the transposable element Minos into tem for autocidal control of the Mediterranean fruitfly. Nature the germ line of Drosophila melanogaster. Proc Natl Acad Sci Biotechnol 23: 453 – 456.
USA 92: 9485 – 9489.
Gossen, M. and Bujard, H. (1992) Tight control of gene expression Loukeris, T.G., Livadaras, I., Arca, B., Zabalou, S. and Savakis, C.
in mammalian cells by tetracycline-responsive promoters. Proc (1995b) Gene transfer into the medfly, Ceratitis capitata, with a Natl Acad Sci USA 89: 5547– 5551.
Drosophila hydei transposable element. Science 270: 2002–
Grossman, G.L., Rafferty, C.S., Clayton, J.R., Stevens, T.K., Mukabayire, O. and Benedict, M.Q. (2001) Germline trans- Markaki, M., Craig, R.K. and Savakis, C. (2004) Insect population formation of the malaria vector, Anopheles gambiae, with control using female specific pro-drug activation. Insect Bio- the piggyBac transposable element. Insect Mol Biol 10: 597–
chem Mol Biol 34: 131– 137.
Mello, C.C., Kramer, J.M., Stinchcomb, D. and Ambros, V. (1992) Handler, A.M., Gomez, S.P. and O’Brochta, D.A. (1993) A func- Efficient gene transfer in C. elegans: extrachromosomal main- tional analysis of the P-element gene-transfer vector in insects.
tenance integration transforming sequences. EMBO Journal Arch Insect Biochem Physiol 22: 373 – 384.
10: 3959 – 3970.
Handler, A.M., McCombs, S.D., Fraser, M.J. and Saul, S.H. (1998) Michel, K., Stamenova, A., Pinkerton, A.C., Franz, G., Robinson, The lepidopteran transposon vector, piggyBac, mediates ger- A.S., Gariou-Papalexiou, A., Zacharopoulou, A., O’Brochta, line transformation in the Mediterranean fruitfly. Proc Natl Acad D.A. and Atkinson, P.W. (2001) Hermes-mediated germ-line Sci USA 95: 7520 – 7525.
transformation of the Mediterranean fruit fly Ceratitis capitata.
Haniotakis, G., Koryzakis, M., Fitsakis, T. and Antonidaki, A.
Insect Mol Biol 10: 155 – 162.
(1991) An effective mass-trapping method for the control of Murashige, T. and Skoog, F. (1962) Revised medium for rapid Dacus oleae (Diptera: Tephritidae). J Econ Entomol 84: 564–
growth and bioessays with tobacco tissue cultures. Physiol Plant 15: 425 – 433.
Hediger, M., Niessen, M., Wimmer, E.A., Dubendorfer, A. and Pavlopoulos, A., Berghammer, A.J., Averof, M. and Klingler, M.
Bopp, D. (2001) Genetic transformation of the housefly Musca (2004) Efficient transformation of the beetle Tribolium casta- domestica with the lepidopteran derived transposon piggyBac.
neum using the Minos transposable element: quantitative and Insect Mol Biol 10: 113 – 119.
qualitative analysis of genomic integration events. Genetics Heinrich, J.C. and Scott, M. (2000) A repressible female-specific 167: 737– 746.
lethal genetic system for making transgenic insect strains suit- Perera, O.P., Harrell, R.A. and Handler, A.M. (2002) Germ-line able for a sterile-release program. Proc Natl Acad Sci USA 97:
transformation of the South American malaria vector, Anophe- les albimanus, with piggyBac/EGFP transposon vector is Heinrich, J.C., Li, X., Henry, R.A., Haack, N., Stringfellow, L., routine and highly efficient. Insect Mol Biol 11: 291– 297.
Heath, A.C.G. and Scott, M.J. (2002) Germ-line transformation Pucci, C. (1990) Valutazione dell’efficacia delle esche proteiche of the Australian sheep blowfly Lucilia cuprina. Insect Mol Biol avvelenate per il controllo del Dacus oleae (Gmel): sperimen- 11: 1– 10.
tazione condotta nel triennio 1988 – 90 nell’alto lazio. Frustula Horn, C. and Wimmer, E.A. (2000) A versatile vector set for animal Entomologica, N S XIII(XXVI): 173 – 198.
transgenesis. Dev Genes Evol 210: 630 – 637.
Rubin, G.M. and Spradling, A.C. (1982) Genetic transformation of Jasinskiene, N., Coates, C.J., Benedict, M.Q., Cornel, A.J., Drosophila with transposable element vectors. Science 218:
Rafferty, C.S., James, A.A. and Collins, F.H. (1998) Stable transformation of the yellow fever mosquito, Aedes aegypti, with Sasakura, Y., Awazu, S., Chiba, S. and Satoh, N. (2003) Germ-line the Hermes element from the housefly. Proc Natl Acad Sci transgenesis of the Tc1/mariner superfamily transposon Minos USA 95: 3743 – 3747.
in Ciona intestinalis. Proc Natl Acad Sci USA 100: 7726 – 7730.
Kapetanaki, M.G., Loukeris, T.G., Livadaras, I. and Savakis, C.
Tamura, T., Thibert, C., Royer, C., Kanda, T., Abraham, E., Kamba, (2002) High frequencies of Minos transposon mobilization are M., Komoto, N., Thomas, J.L., Mauchamp, B., Chavancy, G., obtained in insects by using in vitro synthesized mRNA as a Shirk, P., Fraser, M., Prudhomme, J.C., Couble, P., Toshiki, T., source of transposase. Nucleic Acids Res 30: 3333 – 3340.
Chantal, T., Corinne, R., Toshio, K., Eappen, A., Mari, K., Klinakis, A.G., Loukeris, T.G., Pavlopoulos, A. and Savakis, C.
Natuo, K., Jean-Luc, T., Bernard, M., Gerard, C., Paul, S., Mal- (2000a) Mobility assays confirm the broad host-range activity colm, F., Jean-Claude, P. and Couble, C. (2000) Germline of the Minos transposable element and validate new transfor- transformation of the silkworm Bombyx mori L. using a piggyBac mation tools. Insect Mol Biol 9: 269 – 275.
transposon-derived vector. Nature Biotechnol 18: 81– 84.
2006 The Royal Entomological Society, Insect Molecular Biology, 15, 95–103
Germ line transformation of the olive fruit fly Thomas, D., Donnelly, C., Wood, R. and Alphey, L. (2000) Insect Tzanakakis, M.E. (1995) Entomology, pp. 365–377. University population control using a dominant, repressible, lethal genetic Studio Press, Thessaloniki, Greece. (in Greek) system. Science 287: 2474– 2476.
Wilson, C., Pearson, R.K., Bellen, H.J., O’Kane, C.J., Grossnik- Triglia, T., Peterson, M.G. and Kemp, D.J. (1988) A procedure for laus, U. and Gehring, W.J. (1989) P-element-mediated in vitro amplification of DNA segments that lie outside the enhancer detection: an efficient method for isolating and char- boundaries of known sequences. Nucleic Acids Res 16:
acterizing developmentally regulated genes in Drosophila.
Genes Dev 3: 1301– 1313.
Tzanakakis, M.E. (1989) Small-scale rearing: Dacus oleae. In Fruit Zagoraiou, L., Drabek, D., Alexaki, S., Guy, J.A., Klinakis, A.G., Flies their Biology, Natural Enemies and Control. Vol. 3B.
Langerveld, A., Skavdis, G., Mamalaki, C. and Grosveld, F. (2001) (Robinson, A.S. and Hooper, G., eds), pp. 105 – 118, Elsevier, In vivo transposition of Minos, a Drosophila mobile element, in mammalian tissues. Proc Natl Acad Sci USA 98: 11474–11478.
2006 The Royal Entomological Society, Insect Molecular Biology, 15, 95–103

Source: http://www.tavernarakislab.gr/publications/IMB%20minos.pdf

Mental health glossary 2

North East London NHS Designed and printed by Visualize 020 8527 6225Dr Heather Shearer (North East London Mental Health Trust), KirstyMacLean Steel and Lucy Calas-Prolingheur (East London and The CityMental Health Trust) developed this glossary. We would like to thankeveryone who contributed to its production. This glossary can be used and replicated for non-profit making purposes as

Ações diretas de inconstitucionalidade

Contracepção de emergência: nova pauta do judiciário brasileiro RESUMO: O presente artigo versa sobre a legalidade da distribuição dos contraceptivos de emergência no Brasil. São analisadas decisões judiciais que restringem a distribuição do medicamento, por considerá-lo abortivo, bem como apontadas referências legais que prevêem seu uso enquanto método contraceptivo. Conclui

Copyright © 2014 Medical Pdf Articles